'''
For this exercise, you can use the following documentation:
https://docs.python.org/3/library/stdtypes.html#text-sequence-type-str

# Strings

A sequence is a data structure that contains items arranged in order, and you 
can access each item using an integer index that represents its position in 
the sequence. Note that Python starts counting at zero!

A string is a sequence of characters. It is useful for representing text. 
We make a string by using single or double quotation marks.

In this exercise, we will explore a strand of genetic material. First, check 
the data type of the following strand:
'''

strand = "ACGUGCAGCUCGGGCGAUCGCGCUAAAGCGCAUUCGCGUACGAUGGGCGAA"
# Put your code here

'''
As genetic material is often represented by letters, we use strings to encode 
them. There are a few operations you can perform on strings that make them 
easy to inspect and manipulate. 

As you can see from the strand above, it must be an RNA strand due to the 
presence of uracil. However, you may have a very long string of characters and 
not be able to see immediately whether there are U-bases in the strand. Write a
piece of code that uses a Boolean variable to check whether there are U bases 
in a strand.
'''

contains_U_bases = .. in ..   
# Here, "in" is used to make Python search for a specific character in a string. 
# If found, it returns "True".

print(type(contains_U_bases))
print(f"This strand contains U-bases and is therefore an RNA strand: {contains_U_bases}")

'''
Now, turn this RNA strand into an mRNA strand by adding a G-cap and a 
poly-A-tail. Note that you can add strings together using the `+` operator.
'''

G_cap =
poly_A_tail =
mRNA_strand =