'''
DNA Sequence and If/Else/Elif 

This set of exercises is meant to give practice with using the if, else, and
elif in Python.
 
These will be done on DNA sequences, or rather strings that represent DNA
sequences. This may be helpful in the future if bioinformatics.
'''

'''
Exercise: Pseudocode

For each of the exercises below, start by writing 
pseudocode on a piece of paper. Only once you're done with pseudocode should 
you start working on Python code in VS Code.
'''

'''
Exercise A: DNA subsequence

Write an if statement to check if a DNA subsequence is in a longer sequence.
Store the outcome in Boolean variable in_seq and print the value of in_seq. 
You do not need to use any loops.

You can define DNA_subsequence on your own. Check that your code works both
for subsequences that are and are not contained in the sequence.
'''

DNA = "GGGACATATGCTCCGATTAAAGCGCATGATAGCCCGATAGGTAGATAGGGGTTCACGACG"
DNA_subsequence = # Your code here

# Your code here



'''
Exercise B: DNA subsequence II

Repeat the above, but use also an else statement to set in_seq to false if the 
DNA subsequence is not contained in the sequence. 
You do not need to use any loops.

You can define DNA_subsequence on your own. Check that your code works both
for subsequences that are and are not contained in the sequence.
'''

DNA = "GGGACATATGCTCCGATTAAAGCGCATGATAGCCCGATAGGTAGATAGGGGTTCACGACG"
DNA_subsequence = # Your code here

# Your code here



'''
Exercise C: Handling multiple sequences

What if we want to check for presence of 2 different subsequences in our DNA 
sequence? Write code that informs the user through print statements whether 
subsequence_1, subsequence_2, none or both of them are present in the DNA 
sequence. You do not need to use any loops.
'''

DNA = "GGGACATATGCTCCGATTAAAGCGCATGATAGCCCGATAGGTAGATAGGGGTTCACGACG"
DNA_subsequence_1 = "ATGCTCCG"
DNA_subsequence_2 = "TAGGTAGATATGGGTTC"

# Your code here