'''
In this exercise we will create a function which returns the reverse complement
of a DNA sequence. This is a useful case to create a function as finding the 
reverse complement of any sequence follows the same logic, so instead of 
copy-pasting the code, we create a function and call it every time we need to 
find the reverse complement of a sequence. 

The function should be able to find the reverse complement of any DNA sequence 
(so also for varying lengths). Name the function `reverse_complement`.
You can assume that DNA consists only of A, T, C and G.

After you've defined the function, call it for the given DNA sequence and print 
the output.

Example of a reverse complement:

DNA: ACCTGTAAA
Reverse Complement: TTTACAGGT

Hint: A list or string can be reversed using reversed_var = var_name[::-1] 
'''

DNA = "TTGTGATATAGGTACCAGTCACGTTGACGTAGTCTAGCTAGCATGTCAAGCACTTGAA"

# Your code here