'''
# RNA to mRNA (error types II)

This code checks the length of an RNA strand and the maximum potential length 
of its corresponding protein. Next, it turns the RNA strand into an mRNA 
strand and checks whether this was successful.

The code below will give an error. Figure out the type and the source of the 
error and fix it.
'''

RNA_strand = "ACGACCGGGAAGCACGGACCGGAAGGCGCGACCAAGGCGCACGGGACGUGAACGCCGACGGGACCGGCGACGAC"

# Determination of characteristics
length_of_RNA_strand = len(RNA_strand)
mod_RNA_bases = lenght_of_RNA_strand % 3  # Here, we calculate how many bases are not part of a triplet
maximum_potential_length_protein = (length_of_RNA_strand - mod_RNA_bases) / 3
print(f"The maximum potential length of the protein is {maximum_potential_length_protein:.0f} amino acids.")

# Transformation into mRNA
G_cap = "G"
poly_A_tail = "AAAAAAAAAAAAAAAA"
mRNA_strand = G_cap + RNA_strand + poly_A_tail

successfully_G_capped = (mRNA_strand[0] == "G")  # Looks at the first character in the string
successfully_A_tailed = (mRNA_strand[-5:-1] == "AAAA")  # Looks at the final four characters

print(f"The RNA strand has been successfully transformed into mRNA: {successfully_A_tailed and successfully_G_capped}")
# The word "and" only returns True if both conditions are True.