'''
# Inverting a codon dictionary

Below, you'll find a dictionary showing which codons (only the ones starting 
with an A for simplicity purposes) correspond to which amino acid. In this 
dictionary, the amino acid is the key of each entry, whereas the corresponding 
codons are the values.

In the exercise, you must invert this dictionary, such that the keys are the 
values and the values are amino acids. Note that you need loops for this exercise, 
which will only be covered later in the book, so we recommend only trying this 
exercise if you have some previous programming experience.
'''

amino_acid_to_codon_A = {
    'Lysine': ['AAA', 'AAG'],
    'Asparagine': ['AAC', 'AAU'],
    'Threonine': ['ACA', 'ACC', 'ACG', 'ACU'],
    'Arginine': ['AGA', 'AGG'],
    'Serine': ['AGC', 'AGU'],
    'Isoleucine': ['AUA', 'AUC', 'AUU'],
    'Methionine': ['AUG']
}

codon_to_amino_acid_A = {}

for amino_acid, codons in amino_acid_to_codon_A.items():
# Your code here

'''
Now that you have inverted it, you can use the new dictionary to translate a 
sequence of codons! Try it out with the following sequence:
'''

sequence = "AUGAUAAUUAAGAAGAAAACCAGGAGCAUAAUUAAAACAACG"
# Your code here